This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002466


Marker Name:  S0106 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7982563

PCR Primers

Primer: GCGGCCACCGCTCAAGGGCTGTGC
Primer: CTCAGGAGTCCGTCCGCCGAGTTG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008294
has an Associated Sequence: Local Sequence ID: ARKFSQ00008293

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Clop, Alex et al 2003 (A): 12 Pig
chromosome 12
81.700 81.700 81.700
ENSEMBL52PRE Sscrofa8 Pig Assembly: 12 Pig
chromosome 12
32335410.000 32335479.000 32335548.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 12 Pig
chromosome 12
32041415.000 32041482.000 32041549.000
ENSEMBL56 Sscrofa9 Pig Assembly: 12 Pig
chromosome 12
43459133.000 43459200.000 43459267.000
ENSEMBL56 Sscrofa9 Pig Assembly: 12 Pig
chromosome 12
43748128.000 43748197.000 43748266.000
Nordic v1 (A): 12 Pig
chromosome 12
45.000 45.000 45.000
Nordic v2 (A): 12 Pig
chromosome 12
96.300 96.300 96.300
Nordic v2 (F): 12 Pig
chromosome 12
114.400 114.400 114.400
Nordic v2 (M): 12 Pig
chromosome 12
79.000 79.000 79.000
PiGMaP v1 (A): 12 Pig
chromosome 12
92.000 92.000 92.000
PiGMaP v1 (F): 12 Pig
chromosome 12
127.000 127.000 127.000
PiGMaP v1 (M): 12 Pig
chromosome 12
64.000 64.000 64.000
USDA-MARC v2 (A): 12 Pig
chromosome 12
95.800 95.800 95.800


© The Roslin Institute 2007-2012, all rights reserved