This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002446


Marker Name:  S0091 
Species:  Pig
Marker Type:  OTHER-PCR-TYPES
Publication ID: 8138161

PCR Primers

Primer: TCTACTCCAGGAGATAAGCCAGAT
Primer: CAGTGACTCCATGCACAGTTATGA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008285

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Davoli, R et al 2003 (A): 2 Pig
chromosome 2
69.800 69.800 69.800
ENSEMBL52PRE Sscrofa8 Pig Assembly: 2 Pig
chromosome 2
44238187.000 44238272.500 44238358.000
ENSEMBL56 Sscrofa9 Pig Assembly: 2 Pig
chromosome 2
61930888.000 61930973.500 61931059.000
ENSEMBL67 Ssc10.2 Pig Assembly: 2 Pig
chromosome 2
59648728.000 59648813.500 59648899.000
Fontanesi, L et al 2003 (A): 2 Pig
chromosome 2
56.300 56.300 56.300
Nordic v1 (A): 2 Pig
chromosome 2
41.000 41.000 41.000
Nordic v2 (A): 2 Pig
chromosome 2
48.000 48.000 48.000
Nordic v2 (F): 2 Pig
chromosome 2
46.500 46.500 46.500
Nordic v2 (M): 2 Pig
chromosome 2
49.900 49.900 49.900
PiGMaP Iowa fragment (A): 2 Pig
chromosome 2
29.200 29.200 29.200
PiGMaP SSC2 v1.5 (A): 2 Pig
chromosome 2
55.000 55.000 55.000
PiGMaP SSC2 v1.5 (F): 2 Pig
chromosome 2
46.000 46.000 46.000
PiGMaP SSC2 v1.5 (M): 2 Pig
chromosome 2
63.000 63.000 63.000
PiGMaP v1 (A): 2 Pig
chromosome 2
45.000 45.000 45.000
PiGMaP v1 (F): 2 Pig
chromosome 2
40.000 40.000 40.000
PiGMaP v1 (M): 2 Pig
chromosome 2
49.000 49.000 49.000
Russo, V et al 2004 (A): 2 Pig
chromosome 2
74.000 74.000 74.000
USDA-MARC v1 (A): 2 Pig
chromosome 2
46.500 46.500 46.500
USDA-MARC v2 (A): 2 Pig
chromosome 2
64.300 64.300 64.300


© The Roslin Institute 2007-2012, all rights reserved