This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002444


Marker Name:  S0090 
Species:  Pig
Marker Type:  OTHER-PCR-TYPES
Publication ID: 8138161

PCR Primers

Primer: CCAAGACTGCCTTGTAGGTGAATA
Primer: GCTATCAAGTATTGTACCATTAGG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008284

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL56 Sscrofa9 Pig Assembly: 12 Pig
chromosome 12
35420775.000 35420898.500 35421022.000
ENSEMBL67 Ssc10.2 Pig Assembly: 12 Pig
chromosome 12
38822400.000 38822522.500 38822645.000
Nordic v2 (A): 12 Pig
chromosome 12
72.700 72.700 72.700
Nordic v2 (F): 12 Pig
chromosome 12
77.600 77.600 77.600
Nordic v2 (M): 12 Pig
chromosome 12
70.500 70.500 70.500
PiGMaP v1 (A): 12 Pig
chromosome 12
73.000 73.000 73.000
PiGMaP v1 (F): 12 Pig
chromosome 12
106.000 106.000 106.000
PiGMaP v1 (M): 12 Pig
chromosome 12
51.100 51.100 51.100
Pita, RH et al 2003 (1) (A): 12 Pig
chromosome 12
46.800 46.800 46.800
USDA-MARC v1 (A): 12 Pig
chromosome 12
57.100 57.100 57.100
USDA-MARC v2 (A): 12 Pig
chromosome 12
80.200 80.200 80.200


© The Roslin Institute 2007-2012, all rights reserved