This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002433


Marker Name:  S0085 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7982563

PCR Primers

Primer: AGTCCATCCTGCATGGGTGCACCA
Primer: ATGGCTGAGAGCTTCTGGACAAGC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Johansson, M et al 1994 (A): 3 Pig
chromosome 3
4.100 4.100 4.100
Johansson, M et al 1994 (F): 3 Pig
chromosome 3
7.700 7.700 7.700
Johansson, M et al 1994 (M): 3 Pig
chromosome 3
0.900 0.900 0.900
Nordic v1 (A): 3 Pig
chromosome 3
4.000 4.000 4.000
Nordic v1 (F): 3 Pig
chromosome 3
7.700 7.700 7.700
Nordic v1 (M): 3 Pig
chromosome 3
0.900 0.900 0.900
Nordic v2 (A): 3 Pig
chromosome 3
59.300 59.300 59.300
Nordic v2 (F): 3 Pig
chromosome 3
76.500 76.500 76.500
Nordic v2 (M): 3 Pig
chromosome 3
39.100 39.100 39.100
PiGMaP SSC3 v1.5 (A): 3 Pig
chromosome 3
47.000 47.000 47.000
PiGMaP SSC3 v1.5 (F): 3 Pig
chromosome 3
72.000 72.000 72.000
PiGMaP SSC3 v1.5 (M): 3 Pig
chromosome 3
18.000 18.000 18.000
PiGMaP v1 (A): 3 Pig
chromosome 3
30.000 30.000 30.000
PiGMaP v1 (F): 3 Pig
chromosome 3
38.000 38.000 38.000
PiGMaP v1 (M): 3 Pig
chromosome 3
23.000 23.000 23.000


© The Roslin Institute 2007-2012, all rights reserved