This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002430


Marker Name:  S0083 
Species:  Pig
Marker Type:  OTHER-PCR-TYPES
Publication ID: 8138161

PCR Primers

Primer: AGCTGCGGTATATGAAACCTCCA
Primer: CTGCACCAAGAGATGAGGAAA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Fontanesi, L et al 2003 (A): 12 Pig
chromosome 12
39.300 39.300 39.300
Nordic v1 (A): 12 Pig
chromosome 12
0.000 0.000 0.000
PiGMaP v1 (A): 12 Pig
chromosome 12
32.000 32.000 32.000
PiGMaP v1 (F): 12 Pig
chromosome 12
48.000 48.000 48.000
PiGMaP v1 (M): 12 Pig
chromosome 12
31.000 31.000 31.000
USDA-MARC v1 (A): 12 Pig
chromosome 12
19.500 19.500 19.500
USDA-MARC v2 (A): 12 Pig
chromosome 12
40.200 40.200 40.200


© The Roslin Institute 2007-2012, all rights reserved