This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002409


Marker Name:  S0068 
Species:  Pig
Marker Type:  OTHER-PCR-TYPES
Publication ID: 7749223

PCR Primers

Primer: AGTGGTCTCTCTCCCTCTTGCT
Primer: CCTTCAACCTTTGAGCAAGAAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: M97245

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL67 Ssc10.2 Pig Assembly: 13 Pig
chromosome 13
130538722.000 130538845.000 130538968.000
Jann et al. 2009: 13 Pig
chromosome 13
1425.200 1425.200 1425.200
PiGMaP v1 (A): 13 Pig
chromosome 13
94.000 94.000 94.000
PiGMaP v1 (F): 13 Pig
chromosome 13
96.000 96.000 96.000
PiGMaP v1 (M): 13 Pig
chromosome 13
89.000 89.000 89.000
USDA-MARC v2 (A): 13 Pig
chromosome 13
62.200 62.200 62.200


© The Roslin Institute 2007-2012, all rights reserved