This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002373


Marker Name:  S0038 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: GGGTTTTCTATTGTGTTACCATTGG
Primer: GCCTGACTTCACACTGTACTGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008264

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Clop, Alex et al 2003 (A): 10 Pig
chromosome 10
0.000 0.000 0.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 10 Pig
chromosome 10
3070359.000 3070423.500 3070488.000
ENSEMBL56 Sscrofa9 Pig Assembly: 10 Pig
chromosome 10
3345889.000 3345953.500 3346018.000
ENSEMBL67 Ssc10.2 Pig Assembly: 10 Pig
chromosome 10
4476972.000 4477036.500 4477101.000
PiGMaP SSC10 v1.5 (A): 10 Pig
chromosome 10
8.000 8.000 8.000
PiGMaP SSC10 v1.5 (F): 10 Pig
chromosome 10
9.000 9.000 9.000
PiGMaP SSC10 v1.5 (M): 10 Pig
chromosome 10
5.000 5.000 5.000
USDA-MARC v2 (A): 10 Pig
chromosome 10
4.300 4.300 4.300


© The Roslin Institute 2007-2012, all rights reserved