This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002371


Marker Name:  S0037 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7749223

PCR Primers

Primer: TCTCTGAGGTGATTGTGCATG
Primer: GTTCAATCCCTGCATGGTCT
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008263
has an Associated Sequence: Local Sequence ID: ARKFSQ00008262

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
51587105.000 51587170.500 51587236.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
51506865.000 51506930.500 51506996.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
51038148.000 51038213.500 51038279.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
51112377.000 51112442.500 51112508.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
53465935.000 53466000.500 53466066.000
Fontanesi, L et al 2003 (A): 14 Pig
chromosome 14
27.300 27.300 27.300
PiGMaP SSC14 v1.5 (A): 14 Pig
chromosome 14
45.600 45.600 45.600
PiGMaP SSC14 v1.5 (F): 14 Pig
chromosome 14
44.500 44.500 44.500
PiGMaP SSC14 v1.5 (M): 14 Pig
chromosome 14
49.000 49.000 49.000
PiGMaP v1 (A): 14 Pig
chromosome 14
0.000 0.000 0.000
PiGMaP v1 (F): 14 Pig
chromosome 14
0.000 0.000 0.000
PiGMaP v1 (M): 14 Pig
chromosome 14
0.000 0.000 0.000
USDA-MARC v2 (A): 14 Pig
chromosome 14
40.700 40.700 40.700


© The Roslin Institute 2007-2012, all rights reserved