This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002365


Marker Name:  S0031 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7749223

PCR Primers

Primer: AATGTCCACATGGTTTTATG
Primer: GGGCTTAGATAACTTCTGTT
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008257

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 6 Pig
chromosome 6
37509009.000 37509067.500 37509126.000
ENSEMBL56 Sscrofa9 Pig Assembly: 6 Pig
chromosome 6
75333373.000 75333431.500 75333490.000
ENSEMBL67 Ssc10.2 Pig Assembly: 6 Pig
chromosome 6
102756367.000 102756425.500 102756484.000
Intl Wrkshp.1 (A): 6 Pig
chromosome 6
137.600 137.600 137.600
Intl Wrkshp.1 (F): 6 Pig
chromosome 6
169.300 169.300 169.300
Intl Wrkshp.1 (M): 6 Pig
chromosome 6
105.600 105.600 105.600
Nordic v2 (A): 6 Pig
chromosome 6
115.900 115.900 115.900
Nordic v2 (F): 6 Pig
chromosome 6
142.300 142.300 142.300
Nordic v2 (M): 6 Pig
chromosome 6
93.300 93.300 93.300
PiGMaP v1 (A): 6 Pig
chromosome 6
169.000 169.000 169.000
PiGMaP v1 (F): 6 Pig
chromosome 6
212.000 212.000 212.000
PiGMaP v1 (M): 6 Pig
chromosome 6
131.000 131.000 131.000
USDA-BARC.6 (A): 6 Pig
chromosome 6
81.000 81.000 81.000
USDA-BARC.6 (F): 6 Pig
chromosome 6
118.700 118.700 118.700
USDA-BARC.6 (M): 6 Pig
chromosome 6
63.000 63.000 63.000
USDA-MARC SSC6 v2.5 (A): 6 Pig
chromosome 6
87.100 87.100 87.100
USDA-MARC SSC6 v2.5 (F): 6 Pig
chromosome 6
106.000 106.000 106.000
USDA-MARC SSC6 v2.5 (M): 6 Pig
chromosome 6
69.400 69.400 69.400
USDA-MARC v2 (A): 6 Pig
chromosome 6
102.000 102.000 102.000


© The Roslin Institute 2007-2012, all rights reserved