This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002357


Marker Name:  S0021 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7749223

PCR Primers

Primer: ATCAATCAGAGAAACAGGGT
Primer: TCTTTGTAATCTGTCCTTCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008251

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 13 Pig
chromosome 13
45074933.000 45075039.500 45075146.000
ENSEMBL56 Sscrofa9 Pig Assembly: 13 Pig
chromosome 13
48943851.000 48943957.500 48944064.000
ENSEMBL67 Ssc10.2 Pig Assembly: 13 Pig
chromosome 13
64156278.000 64156384.500 64156491.000
Jann et al. 2009: 13 Pig
chromosome 13
1281.000 1281.000 1281.000
PiGMaP v1 (A): 13 Pig
chromosome 13
79.000 79.000 79.000
PiGMaP v1 (F): 13 Pig
chromosome 13
86.000 86.000 86.000
PiGMaP v1 (M): 13 Pig
chromosome 13
70.000 70.000 70.000
USDA-MARC v2 (A): 13 Pig
chromosome 13
61.100 61.100 61.100


© The Roslin Institute 2007-2012, all rights reserved