This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002346


Marker Name:  S0014 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7749223

PCR Primers

Primer: AGGGTCAGCAAAGTTAGAGC
Primer: CCTGGCATGTAGCATGTAGTCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008247

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Civanova, K. et al 2004 (A): 17 Pig
chromosome 17
86.900 86.900 86.900
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
51879791.000 51880321.500 51880852.000
ENSEMBL56 Sscrofa9 Pig Assembly: 17 Pig
chromosome 17
59804432.000 59804962.500 59805493.000
ENSEMBL67 Ssc10.2 Pig Assembly: 17 Pig
chromosome 17
64433234.000 64433764.500 64434295.000
Nordic v2 (A): 17 Pig
chromosome 17
113.500 113.500 113.500
Nordic v2 (F): 17 Pig
chromosome 17
139.400 139.400 139.400
Nordic v2 (M): 17 Pig
chromosome 17
97.000 97.000 97.000
PiGMaP v1 (A): 17 Pig
chromosome 17
97.000 97.000 97.000
PiGMaP v1 (F): 17 Pig
chromosome 17
186.000 186.000 186.000
PiGMaP v1 (M): 17 Pig
chromosome 17
46.000 46.000 46.000
USDA-MARC current (A): 17 Pig
chromosome 17
88.700 88.700 88.700
USDA-MARC v2 (A): 17 Pig
chromosome 17
88.700 88.700 88.700


© The Roslin Institute 2007-2012, all rights reserved