This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002338


Marker Name:  S0007 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7749223

PCR Primers

Primer: TTACTTCTTTGGATCATGTC
Primer: GTCCCTCCTCATAATTTCTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: M97234
has an Associated Sequence: Local Sequence ID: ARKFSQ00008241

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
117398577.000 117398674.000 117398771.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
116656849.000 116656946.000 116657043.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
121380965.000 121381062.000 121381159.000
Fernandez, A et al 2003 (A): 14 Pig
chromosome 14
69.700 69.700 69.700
NIAI-Japan QTL v2 (A): 14 Pig
chromosome 14
95.100 95.100 95.100
NIAI-Japan v1 (A): 14 Pig
chromosome 14
93.200 93.200 93.200
NIAI-Japan v1 (F): 14 Pig
chromosome 14
111.000 111.000 111.000
NIAI-Japan v1 (M): 14 Pig
chromosome 14
75.800 75.800 75.800
Nordic v2 (A): 14 Pig
chromosome 14
82.500 82.500 82.500
Nordic v2 (F): 14 Pig
chromosome 14
95.500 95.500 95.500
Nordic v2 (M): 14 Pig
chromosome 14
71.100 71.100 71.100
PiGMaP SSC14 v1.5 (A): 14 Pig
chromosome 14
107.700 107.700 107.700
PiGMaP SSC14 v1.5 (F): 14 Pig
chromosome 14
103.500 103.500 103.500
PiGMaP SSC14 v1.5 (M): 14 Pig
chromosome 14
113.700 113.700 113.700
PiGMaP v1 (A): 14 Pig
chromosome 14
75.000 75.000 75.000
PiGMaP v1 (F): 14 Pig
chromosome 14
64.000 64.000 64.000
PiGMaP v1 (M): 14 Pig
chromosome 14
88.000 88.000 88.000
USDA-MARC v2 (A): 14 Pig
chromosome 14
60.000 60.000 60.000


© The Roslin Institute 2007-2012, all rights reserved