This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00001952


Marker Name:  PDYN 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7749223

PCR Primers

Primer: CCTCTCAAGATGTTCTGAAATCTA
Primer: TATTTATTGTACTGAAGGAGCAGG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008225

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
29922745.000 29922815.500 29922886.000
ENSEMBL56 Sscrofa9 Pig Assembly: 17 Pig
chromosome 17
35054906.000 35054976.500 35055047.000
Nordic v2 (A): 17 Pig
chromosome 17
66.400 66.400 66.400
Nordic v2 (F): 17 Pig
chromosome 17
72.400 72.400 72.400
Nordic v2 (M): 17 Pig
chromosome 17
62.400 62.400 62.400
PiGMaP v1 (A): 17 Pig
chromosome 17
72.000 72.000 72.000
PiGMaP v1 (F): 17 Pig
chromosome 17
143.000 143.000 143.000
PiGMaP v1 (M): 17 Pig
chromosome 17
28.000 28.000 28.000
USDA-MARC current (A): 17 Pig
chromosome 17
42.700 42.700 42.700
USDA-MARC v2 (A): 17 Pig
chromosome 17
42.700 42.700 42.700


© The Roslin Institute 2007-2012, all rights reserved