This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00001884


Marker Name:  OTC 
Species:  Pig
Marker Type:  Southern-Blot
Publication ID: not available  

PCR Primers

Primer: GTCTAGCATGACAGATGCAGTG
Primer: CAGGATCTGGATAGGATGGTAC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008222

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: X Pig
chromosome X
21494915.000 21494978.000 21495041.000
ENSEMBL56 Sscrofa9 Pig Assembly: X Pig
chromosome X
33819799.000 33819862.000 33819925.000
ENSEMBL67 Ssc10.2 Pig Assembly: X Pig
chromosome X
38230791.000 38230854.000 38230917.000
USDA-MARC current (A): X Pig
chromosome X
44.000 44.000 44.000


© The Roslin Institute 2007-2012, all rights reserved