This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00001768


Marker Name:  MX1 
Species:  Pig
Marker Type:  OTHER-PCR-TYPES
Publication ID: 7749223

PCR Primers

Primer: TCTTGACGAAAGCCGGATAT
Primer: ATAGGCTTCTATGTGCATCCATCCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: M65087

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
PiGMaP v1 (A): 13 Pig
chromosome 13
154.000 154.000 154.000
PiGMaP v1 (F): 13 Pig
chromosome 13
152.000 152.000 152.000
PiGMaP v1 (M): 13 Pig
chromosome 13
153.000 153.000 153.000


© The Roslin Institute 2007-2012, all rights reserved