This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00001267


Marker Name:  HMGB2 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: GAGGAAGAAGATGAAGACGAGG
Primer: TTAGCAAAATAATTGCCTGAGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: J02895
has an Associated Sequence: Local Sequence ID: ARKFSQ00008200

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
17421747.000 17421801.500 17421856.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
16306439.000 16306493.500 16306548.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
17862331.000 17862385.500 17862440.000
USDA-MARC v2 (A): 14 Pig
chromosome 14
21.500 21.500 21.500


© The Roslin Institute 2007-2012, all rights reserved