This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00001200


Marker Name:  GPI 
Species:  Pig
Marker Type:  VNTR
Publication ID: 8138161

PCR Primers

Primer: GTGTCCGGAGTGGCGAATG
Primer: GGAGGCAATGATGAACAGGGAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: Z28398
has an Associated Sequence: Local Sequence ID: ARKFSQ00008198

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 6 Pig
chromosome 6
15517266.000 15517458.500 15517651.000
ENSEMBL56 Sscrofa9 Pig Assembly: 6 Pig
chromosome 6
29433575.000 29433767.500 29433960.000
ENSEMBL67 Ssc10.2 Pig Assembly: 6 Pig
chromosome 6
39536613.000 39536805.500 39536998.000
Intl Wrkshp.1 (A): 6 Pig
chromosome 6
94.700 94.700 94.700
Intl Wrkshp.1 (F): 6 Pig
chromosome 6
121.500 121.500 121.500
Intl Wrkshp.1 (M): 6 Pig
chromosome 6
67.900 67.900 67.900
Johansson, M et al 1994 (A): 6 Pig
chromosome 6
34.000 34.000 34.000
Johansson, M et al 1994 (F): 6 Pig
chromosome 6
46.800 46.800 46.800
Johansson, M et al 1994 (M): 6 Pig
chromosome 6
20.100 20.100 20.100
Nordic v1 (A): 6 Pig
chromosome 6
36.000 36.000 36.000
Nordic v2 (A): 6 Pig
chromosome 6
79.200 79.200 79.200
Nordic v2 (F): 6 Pig
chromosome 6
104.100 104.100 104.100
Nordic v2 (M): 6 Pig
chromosome 6
57.800 57.800 57.800
PiGMaP v1 (A): 6 Pig
chromosome 6
100.000 100.000 100.000
PiGMaP v1 (F): 6 Pig
chromosome 6
143.000 143.000 143.000
PiGMaP v1 (M): 6 Pig
chromosome 6
64.000 64.000 64.000
USDA-BARC.6 (A): 6 Pig
chromosome 6
56.700 56.700 56.700
USDA-BARC.6 (F): 6 Pig
chromosome 6
77.200 77.200 77.200
USDA-BARC.6 (M): 6 Pig
chromosome 6
42.100 42.100 42.100
USDA-MARC SSC6 v2.5 (A): 6 Pig
chromosome 6
57.700 57.700 57.700
USDA-MARC SSC6 v2.5 (F): 6 Pig
chromosome 6
69.900 69.900 69.900
USDA-MARC SSC6 v2.5 (M): 6 Pig
chromosome 6
47.800 47.800 47.800
USDA-MARC v1 (A): 6 Pig
chromosome 6
72.500 72.500 72.500


© The Roslin Institute 2007-2012, all rights reserved