This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00000636


Marker Name:  CALCA 
Species:  Pig
Marker Type:  PCR-RFLP
Publication ID: 12078754

PCR Primers

Primer: TTCTCCTTCCTCTGCTTCTG
Primer: GCAAACCCAATACAGGCTCT
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL67 Ssc10.2 Pig Assembly: 2 Pig
chromosome 2
47252386.000 47252497.500 47252609.000
PiGMaP Iowa fragment (A): 2 Pig
chromosome 2
19.300 19.300 19.300


© The Roslin Institute 2007-2012, all rights reserved