This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00000386


Marker Name:  ACTN2 
Species:  Pig
Marker Type:  PCR-RFLP
Publication ID: 7749223

PCR Primers

Primer: AACAGAGAGGGGAGGTACAGCATTT
Primer: AATTCATTCCGTGCGGTAGGAGTTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L20458
has an Associated Sequence: Local Sequence ID: ARKFSQ00008162

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
56530013.000 56530123.500 56530234.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
55840115.000 55840225.500 55840336.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
58645770.000 58645880.500 58645991.000
PiGMaP SSC14 v1.5 (A): 14 Pig
chromosome 14
88.900 88.900 88.900
PiGMaP SSC14 v1.5 (F): 14 Pig
chromosome 14
86.800 86.800 86.800
PiGMaP SSC14 v1.5 (M): 14 Pig
chromosome 14
91.800 91.800 91.800
PiGMaP v1 (A): 14 Pig
chromosome 14
65.000 65.000 65.000
PiGMaP v1 (F): 14 Pig
chromosome 14
54.000 54.000 54.000
PiGMaP v1 (M): 14 Pig
chromosome 14
82.000 82.000 82.000


© The Roslin Institute 2007-2012, all rights reserved