This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005442


Marker Name:  HUJ0002 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CATCTCACAGAGCCAGCAGTG
Primer: GAATCCTGGATGTCAAAGCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L10228

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 17 Chicken
chromosome 17
36.000 36.000 36.000
Consensus 2005 (A): 17 Chicken
chromosome 17
35.000 36.000 37.000
East Lansing (M): 17 Chicken
chromosome 17
47.430 47.430 47.430
Wageningen (A): 17 Chicken
chromosome 17
42.600 42.600 42.600
Wageningen (F): 17 Chicken
chromosome 17
42.800 42.800 42.800
Wageningen (M): 17 Chicken
chromosome 17
42.300 42.300 42.300


© The Roslin Institute 2007-2012, all rights reserved