This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004945


Marker Name:  AK1 
Species:  Chicken
Marker Type:  OTHER-PCR-TYPES
Publication ID: 7910177

PCR Primers

Primer: CTGAAGCACCACAAGATCCATCT
Primer: AGGTGTCTGCCTTAGCCAACAT
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 17 Chicken
chromosome 17
29.000 29.000 29.000
East Lansing (M): 17 Chicken
chromosome 17
41.440 41.440 41.440


© The Roslin Institute 2007-2012, all rights reserved