This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004820


Marker Name:  ADL0293 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: ACATACCGCAGTCTTTGTTC
Primer: GTAATCTAGAAACCCCATCT
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003553
has an Associated Sequence: Sequence Genbank ID: G01711

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 17 Chicken
chromosome 17
26.000 26.000 26.000
Consensus 2005 (A): 17 Chicken
chromosome 17
25.000 26.000 27.000
East Lansing (M): 17 Chicken
chromosome 17
37.590 37.590 37.590
ENSEMBL53 WASHUC2 Chicken Assembly: 17 Chicken
chromosome 17
6394368.000 6394424.500 6394481.000
ENSEMBL71 Galgal4 Chick Assembly: 17 Chicken
chromosome 17
5814029.000 5814085.500 5814142.000
Kerje et al. 2003a (A): 17 Chicken
chromosome 17
0.000 0.000 0.000
Kerje, S et al. 2003 (A): 17 Chicken
chromosome 17
0.000 0.000 0.000
Wageningen (A): 17 Chicken
chromosome 17
37.200 37.200 37.200
Wageningen (F): 17 Chicken
chromosome 17
37.300 37.300 37.300
Wageningen (M): 17 Chicken
chromosome 17
36.900 36.900 36.900


© The Roslin Institute 2007-2012, all rights reserved