This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00016949


Marker Name:  LEX31 
Species:  Horse
Marker Type:  Microsatellite
Publication ID: 9750194

PCR Primers

Primer: CCCATTAAGAACTTTTCATCCTG
Primer: GGCAAGCCCCACAAAATTAT
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Lindgren, Gabriella et al 1998 (M): 21 Horse
chromosome 21
36.000 36.000 36.000


© The Roslin Institute 2007-2012, all rights reserved