This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011975


Marker Name:  OARCP0099 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: GTTTACCACTAAGCCACCAGGGAAGC
Primer: CCTTACACTCTGATAGAGGATATTTAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U15940

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 16 Sheep
chromosome 16
21.700 21.700 21.700
SM2 (A): 16 Sheep
chromosome 16
27.200 27.200 27.200
SM3 (A): 16 Sheep
chromosome 16
24.200 24.200 24.200
SM3 Best Positions (A): 16 Sheep
chromosome 16
24.800 24.800 24.800
SM3 Best Positions (F): 16 Sheep
chromosome 16
12.100 12.100 12.100
SM3 Best Positions (M): 16 Sheep
chromosome 16
30.500 30.500 30.500
SM3 Framework (F): 16 Sheep
chromosome 16
32.500 32.500 32.500
SM3 Framework (M): 16 Sheep
chromosome 16
26.100 26.100 26.100
SM4 Best Positions (A): 16 Sheep
chromosome 16
25.000 25.000 25.000
SM4 Framework (A): 16 Sheep
chromosome 16
24.800 24.800 24.800
SM4 Framework (F): 16 Sheep
chromosome 16
29.800 29.800 29.800
SM4 Framework (M): 16 Sheep
chromosome 16
28.400 28.400 28.400
SM4.2 Best Positions (A): 16 Sheep
chromosome 16
25.000 25.000 25.000
SM4.2 Best Positions (F): 16 Sheep
chromosome 16
25.300 25.300 25.300
SM4.2 Best Positions (M): 16 Sheep
chromosome 16
32.100 32.100 32.100
SM4.2 Framework (A): 16 Sheep
chromosome 16
24.800 24.800 24.800
SM4.2 Framework (F): 16 Sheep
chromosome 16
29.800 29.800 29.800
SM4.2 Framework (M): 16 Sheep
chromosome 16
28.400 28.400 28.400
SMC (A): 16 Sheep
chromosome 16
27.200 27.200 27.200


© The Roslin Institute 2007-2012, all rights reserved