This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011965


Marker Name:  OARCP0023 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: GGGGTCACAAAGAGTCAGACATGC
Primer: CTATGCTTAACATGTTCTAGAACACG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U15697

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 16 Sheep
chromosome 16
24.700 24.700 24.700
SM2 (A): 16 Sheep
chromosome 16
21.700 21.700 21.700
SM3 Best Positions (A): 16 Sheep
chromosome 16
15.300 15.300 15.300
SM3 Best Positions (F): 16 Sheep
chromosome 16
8.700 8.700 8.700
SM3 Best Positions (M): 16 Sheep
chromosome 16
21.300 21.300 21.300
SM4 Best Positions (A): 16 Sheep
chromosome 16
15.800 15.800 15.800
SM4.2 Best Positions (A): 16 Sheep
chromosome 16
15.800 15.800 15.800
SM4.2 Best Positions (F): 16 Sheep
chromosome 16
8.300 8.300 8.300
SM4.2 Best Positions (M): 16 Sheep
chromosome 16
22.400 22.400 22.400
SMC (A): 16 Sheep
chromosome 16
21.700 21.700 21.700


© The Roslin Institute 2007-2012, all rights reserved