This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011691


Marker Name:  MAF0214 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: GGGTGATCTTAGGGAGGTTTTGGAGG
Primer: AATGCAGGAGATCTGAGGCAGGGACG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: M88160

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 16 Sheep
chromosome 16
42.000 42.000 42.000
SM2 (A): 16 Sheep
chromosome 16
50.200 50.200 50.200
SM3 (A): 16 Sheep
chromosome 16
43.900 43.900 43.900
SM3 Best Positions (A): 16 Sheep
chromosome 16
45.800 45.800 45.800
SM3 Best Positions (F): 16 Sheep
chromosome 16
41.600 41.600 41.600
SM3 Best Positions (M): 16 Sheep
chromosome 16
49.400 49.400 49.400
SM3 Framework (F): 16 Sheep
chromosome 16
42.700 42.700 42.700
SM3 Framework (M): 16 Sheep
chromosome 16
46.000 46.000 46.000
SM4 Best Positions (A): 16 Sheep
chromosome 16
45.300 45.300 45.300
SM4 Framework (A): 16 Sheep
chromosome 16
43.300 43.300 43.300
SM4 Framework (F): 16 Sheep
chromosome 16
37.500 37.500 37.500
SM4 Framework (M): 16 Sheep
chromosome 16
47.000 47.000 47.000
SM4.2 Best Positions (A): 16 Sheep
chromosome 16
45.300 45.300 45.300
SM4.2 Best Positions (F): 16 Sheep
chromosome 16
39.300 39.300 39.300
SM4.2 Best Positions (M): 16 Sheep
chromosome 16
49.900 49.900 49.900
SM4.2 Framework (A): 16 Sheep
chromosome 16
43.300 43.300 43.300
SM4.2 Framework (F): 16 Sheep
chromosome 16
37.500 37.500 37.500
SM4.2 Framework (M): 16 Sheep
chromosome 16
47.000 47.000 47.000
SMC (A): 16 Sheep
chromosome 16
50.200 50.200 50.200


© The Roslin Institute 2007-2012, all rights reserved