This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012403
Marker Name:  URB0051 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: ACAGCAGTGAACGGAGTGGAA
Primer: TCCACCCGGTGGTCACCTAAA
 

Related Sequences
has an Associated Sequence: Sequence Genbank ID: U21781

Related Markers
No Related Markers Found.

Related Maps

  Map Name Species Start
Position		 Middle
Position		 End
Position
SM3 Best Positions (A): 5 Sheep
chromosome 5 		22.600 22.600 22.600
SM3 Best Positions (F): 5 Sheep
chromosome 5 		22.000 22.000 22.000
SM3 Best Positions (M): 5 Sheep
chromosome 5 		22.500 22.500 22.500
SM4 Best Positions (A): 5 Sheep
chromosome 5 		22.600 22.600 22.600
SM4.2 Best Positions (A): 5 Sheep
chromosome 5 		26.600 26.600 26.600
SM4.2 Best Positions (F): 5 Sheep
chromosome 5 		20.800 20.800 20.800
SM4.2 Best Positions (M): 5 Sheep
chromosome 5 		32.500 32.500 32.500


© The Roslin Institute 2007-2012, all rights reserved