This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012403


Marker Name:  URB0051 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: ACAGCAGTGAACGGAGTGGAA
Primer: TCCACCCGGTGGTCACCTAAA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U21781

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 Best Positions (A): 5 Sheep
chromosome 5
22.600 22.600 22.600
SM3 Best Positions (F): 5 Sheep
chromosome 5
22.000 22.000 22.000
SM3 Best Positions (M): 5 Sheep
chromosome 5
22.500 22.500 22.500
SM4 Best Positions (A): 5 Sheep
chromosome 5
22.600 22.600 22.600
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
26.600 26.600 26.600
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
20.800 20.800 20.800
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
32.500 32.500 32.500


© The Roslin Institute 2007-2012, all rights reserved