This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012300


Marker Name:  TGLA0176 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: GCTTTAAGAACTGCTCTCAAGGCAC
Primer: CTGGGTGAGAAATGGGTAGTAGG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 5 Sheep
chromosome 5
0.000 0.000 0.000
SM3 (A): 5 Sheep
chromosome 5
13.900 13.900 13.900
SM3 Best Positions (A): 5 Sheep
chromosome 5
13.900 13.900 13.900
SM3 Best Positions (F): 5 Sheep
chromosome 5
13.900 13.900 13.900
SM3 Best Positions (M): 5 Sheep
chromosome 5
13.400 13.400 13.400
SM3 Framework (F): 5 Sheep
chromosome 5
13.900 13.900 13.900
SM3 Framework (M): 5 Sheep
chromosome 5
13.400 13.400 13.400
SM4 Best Positions (A): 5 Sheep
chromosome 5
13.900 13.900 13.900
SM4 Framework (A): 5 Sheep
chromosome 5
13.800 13.800 13.800
SM4 Framework (F): 5 Sheep
chromosome 5
13.900 13.900 13.900
SM4 Framework (M): 5 Sheep
chromosome 5
13.400 13.400 13.400
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
17.800 17.800 17.800
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
12.600 12.600 12.600
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
23.500 23.500 23.500
SM4.2 Framework (A): 5 Sheep
chromosome 5
18.200 18.200 18.200
SM4.2 Framework (F): 5 Sheep
chromosome 5
12.800 12.800 12.800
SM4.2 Framework (M): 5 Sheep
chromosome 5
23.500 23.500 23.500
SMC (A): 5 Sheep
chromosome 5
0.000 0.000 0.000


© The Roslin Institute 2007-2012, all rights reserved