This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012297


Marker Name:  TGLA0137 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: GTTGACTTGTTAATCACTGACAGCC
Primer: CCTTAGACACACGTGAAGTCCAC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 5 Sheep
chromosome 5
9.400 9.400 9.400
SM2 (A): 5 Sheep
chromosome 5
103.600 103.600 103.600
SM3 (A): 5 Sheep
chromosome 5
111.500 111.500 111.500
SM3 Best Positions (A): 5 Sheep
chromosome 5
109.400 109.400 109.400
SM3 Best Positions (F): 5 Sheep
chromosome 5
112.100 112.100 112.100
SM3 Best Positions (M): 5 Sheep
chromosome 5
108.800 108.800 108.800
SM3 Framework (F): 5 Sheep
chromosome 5
116.900 116.900 116.900
SM3 Framework (M): 5 Sheep
chromosome 5
109.800 109.800 109.800
SM4 Best Positions (A): 5 Sheep
chromosome 5
108.700 108.700 108.700
SM4 Framework (A): 5 Sheep
chromosome 5
112.100 112.100 112.100
SM4 Framework (F): 5 Sheep
chromosome 5
119.400 119.400 119.400
SM4 Framework (M): 5 Sheep
chromosome 5
108.000 108.000 108.000
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
113.100 113.100 113.100
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
111.600 111.600 111.600
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
116.600 116.600 116.600
SM4.2 Framework (A): 5 Sheep
chromosome 5
116.500 116.500 116.500
SM4.2 Framework (F): 5 Sheep
chromosome 5
118.100 118.100 118.100
SM4.2 Framework (M): 5 Sheep
chromosome 5
118.100 118.100 118.100
SMC (A): 5 Sheep
chromosome 5
103.600 103.600 103.600


© The Roslin Institute 2007-2012, all rights reserved