This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011959


Marker Name:  OARAE0129 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: AATCCAGTGTGTGAAAGACTAATCCAG
Primer: GTAGATCAAGATATAGAATATTTTTCAACACC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L11051

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 5 Sheep
chromosome 5
5.800 5.800 5.800
SM2 (A): 5 Sheep
chromosome 5
107.500 107.500 107.500
SM3 (A): 5 Sheep
chromosome 5
115.400 115.400 115.400
SM3 Best Positions (A): 5 Sheep
chromosome 5
114.000 114.000 114.000
SM3 Best Positions (F): 5 Sheep
chromosome 5
116.900 116.900 116.900
SM3 Best Positions (M): 5 Sheep
chromosome 5
108.800 108.800 108.800
SM3 Framework (F): 5 Sheep
chromosome 5
121.800 121.800 121.800
SM3 Framework (M): 5 Sheep
chromosome 5
109.800 109.800 109.800
SM4 Best Positions (A): 5 Sheep
chromosome 5
111.900 111.900 111.900
SM4 Framework (A): 5 Sheep
chromosome 5
116.200 116.200 116.200
SM4 Framework (F): 5 Sheep
chromosome 5
124.500 124.500 124.500
SM4 Framework (M): 5 Sheep
chromosome 5
108.000 108.000 108.000
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
116.200 116.200 116.200
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
116.600 116.600 116.600
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
116.600 116.600 116.600
SM4.2 Framework (A): 5 Sheep
chromosome 5
120.100 120.100 120.100
SM4.2 Framework (F): 5 Sheep
chromosome 5
123.200 123.200 123.200
SM4.2 Framework (M): 5 Sheep
chromosome 5
118.100 118.100 118.100
SMC (A): 5 Sheep
chromosome 5
107.500 107.500 107.500


© The Roslin Institute 2007-2012, all rights reserved