This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011764


Marker Name:  MCM0527 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: GTCCATTGCCTCAAATCAATTC
Primer: AAACCACTTGACTACTCCCCAA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 5 Sheep
chromosome 5
0.100 0.100 0.100
SM2 (A): 5 Sheep
chromosome 5
112.400 112.400 112.400
SM3 (A): 5 Sheep
chromosome 5
120.300 120.300 120.300
SM3 Best Positions (A): 5 Sheep
chromosome 5
118.900 118.900 118.900
SM3 Best Positions (F): 5 Sheep
chromosome 5
121.800 121.800 121.800
SM3 Best Positions (M): 5 Sheep
chromosome 5
117.100 117.100 117.100
SM3 Framework (F): 5 Sheep
chromosome 5
126.700 126.700 126.700
SM3 Framework (M): 5 Sheep
chromosome 5
115.800 115.800 115.800
SM4 Best Positions (A): 5 Sheep
chromosome 5
126.000 126.000 126.000
SM4 Framework (A): 5 Sheep
chromosome 5
121.200 121.200 121.200
SM4 Framework (F): 5 Sheep
chromosome 5
129.600 129.600 129.600
SM4 Framework (M): 5 Sheep
chromosome 5
114.100 114.100 114.100
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
125.400 125.400 125.400
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
125.800 125.800 125.800
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
126.600 126.600 126.600
SMC (A): 5 Sheep
chromosome 5
112.400 112.400 112.400


© The Roslin Institute 2007-2012, all rights reserved