This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011757


Marker Name:  MCM0380 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TAAGAACCACTTTGGGGACTCC
Primer: AGGGCTCTGACTGCTTTGTGT
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 5 Sheep
chromosome 5
21.800 21.800 21.800
SM3 Best Positions (A): 5 Sheep
chromosome 5
22.600 22.600 22.600
SM3 Best Positions (F): 5 Sheep
chromosome 5
22.300 22.300 22.300
SM3 Best Positions (M): 5 Sheep
chromosome 5
22.500 22.500 22.500
SM3 Framework (F): 5 Sheep
chromosome 5
22.100 22.100 22.100
SM3 Framework (M): 5 Sheep
chromosome 5
20.400 20.400 20.400
SM4 Best Positions (A): 5 Sheep
chromosome 5
22.600 22.600 22.600
SM4 Framework (A): 5 Sheep
chromosome 5
21.800 21.800 21.800
SM4 Framework (F): 5 Sheep
chromosome 5
22.100 22.100 22.100
SM4 Framework (M): 5 Sheep
chromosome 5
20.400 20.400 20.400
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
26.600 26.600 26.600
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
20.900 20.900 20.900
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
32.500 32.500 32.500
SM4.2 Framework (A): 5 Sheep
chromosome 5
26.200 26.200 26.200
SM4.2 Framework (F): 5 Sheep
chromosome 5
21.000 21.000 21.000
SM4.2 Framework (M): 5 Sheep
chromosome 5
30.500 30.500 30.500


© The Roslin Institute 2007-2012, all rights reserved