This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011718


Marker Name:  MCM0108 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CTTAAGCCAGGTGTTTCAAAGATG
Primer: TCTCTTTTTCTCTCTCTCTCTGAAACA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 5 Sheep
chromosome 5
130.300 130.300 130.300
SM3 Best Positions (A): 5 Sheep
chromosome 5
128.600 128.600 128.600
SM3 Best Positions (F): 5 Sheep
chromosome 5
129.800 129.800 129.800
SM3 Best Positions (M): 5 Sheep
chromosome 5
127.900 127.900 127.900
SM3 Framework (F): 5 Sheep
chromosome 5
134.900 134.900 134.900
SM3 Framework (M): 5 Sheep
chromosome 5
126.900 126.900 126.900
SM4 Best Positions (A): 5 Sheep
chromosome 5
135.700 135.700 135.700
SM4 Framework (A): 5 Sheep
chromosome 5
131.200 131.200 131.200
SM4 Framework (F): 5 Sheep
chromosome 5
137.800 137.800 137.800
SM4 Framework (M): 5 Sheep
chromosome 5
125.100 125.100 125.100
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
135.100 135.100 135.100
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
133.800 133.800 133.800
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
137.400 137.400 137.400
SM4.2 Framework (A): 5 Sheep
chromosome 5
138.600 138.600 138.600
SM4.2 Framework (F): 5 Sheep
chromosome 5
141.000 141.000 141.000
SM4.2 Framework (M): 5 Sheep
chromosome 5
138.500 138.500 138.500


© The Roslin Institute 2007-2012, all rights reserved