This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011559


Marker Name:  INRA0192 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: GACCTTTACAGCCACCTCTTC
Primer: TGTTTTAATTTGCATTTCCTGA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X73942

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 5 Sheep
chromosome 5
81.600 81.600 81.600
SM3 Best Positions (A): 5 Sheep
chromosome 5
86.100 86.100 86.100
SM3 Best Positions (F): 5 Sheep
chromosome 5
80.800 80.800 80.800
SM3 Best Positions (M): 5 Sheep
chromosome 5
91.100 91.100 91.100
SM4 Best Positions (A): 5 Sheep
chromosome 5
90.300 90.300 90.300
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
94.300 94.300 94.300
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
80.400 80.400 80.400
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
107.900 107.900 107.900
SMC (A): 5 Sheep
chromosome 5
81.600 81.600 81.600


© The Roslin Institute 2007-2012, all rights reserved