This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011393


Marker Name:  IL5 
Species:  Sheep
Marker Type:  SSCP
Publication ID: 11435411

PCR Primers

Primer: GACAGTTTCCTACGATGCTTATTGTC
Primer: TCTCCTCCAGAAACTTTCACTACAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U17053

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 Best Positions (A): 5 Sheep
chromosome 5
34.800 34.800 34.800
SM3 Best Positions (F): 5 Sheep
chromosome 5
28.400 28.400 28.400
SM3 Best Positions (M): 5 Sheep
chromosome 5
40.500 40.500 40.500
SM4 Best Positions (A): 5 Sheep
chromosome 5
34.700 34.700 34.700
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
38.700 38.700 38.700
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
27.100 27.100 27.100
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
50.400 50.400 50.400


© The Roslin Institute 2007-2012, all rights reserved