This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011376


Marker Name:  IL12B 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: not available  

PCR Primers

Primer: CCAAATGCCAGGACCTCACAGT
Primer: GGCTGCCACTCTTTCCTCTGTCT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF205788

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM4 Best Positions (A): 5 Sheep
chromosome 5
99.000 99.000 99.000
SM4 Framework (A): 5 Sheep
chromosome 5
100.200 100.200 100.200
SM4 Framework (F): 5 Sheep
chromosome 5
100.200 100.200 100.200
SM4 Framework (M): 5 Sheep
chromosome 5
101.600 101.600 101.600
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
102.900 102.900 102.900
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
92.100 92.100 92.100
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
112.800 112.800 112.800
SM4.2 Framework (A): 5 Sheep
chromosome 5
104.500 104.500 104.500
SM4.2 Framework (F): 5 Sheep
chromosome 5
99.100 99.100 99.100
SM4.2 Framework (M): 5 Sheep
chromosome 5
111.700 111.700 111.700
SM4.6 Best Positions (A): 5 Sheep
chromosome 5
103.200 103.200 103.200
SM4.6 Best Positions (F): 5 Sheep
chromosome 5
91.100 91.100 91.100
SM4.6 Best Positions (M): 5 Sheep
chromosome 5
115.100 115.100 115.100
SM4.7 Best Positions (A): 5 Sheep
chromosome 5
103.200 103.200 103.200


© The Roslin Institute 2007-2012, all rights reserved