This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011248


Marker Name:  EPCDV0026 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: not available  

PCR Primers

Primer: GATTGCCCCTGTTATGTTGGT
Primer: GCTTACTTCGTGAAAGTATGTG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM4 Best Positions (A): 5 Sheep
chromosome 5
118.100 118.100 118.100
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
117.200 117.200 117.200
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
116.600 116.600 116.600
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
119.100 119.100 119.100


© The Roslin Institute 2007-2012, all rights reserved