This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011234


Marker Name:  EPCDV0017 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: GCACCCCAAGGTTCATTACA
Primer: CATCCTTGTTGCTGCATATTG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 5 Sheep
chromosome 5
92.600 92.600 92.600
SM3 Best Positions (A): 5 Sheep
chromosome 5
90.700 90.700 90.700
SM3 Best Positions (F): 5 Sheep
chromosome 5
83.100 83.100 83.100
SM3 Best Positions (M): 5 Sheep
chromosome 5
97.600 97.600 97.600
SM3 Framework (F): 5 Sheep
chromosome 5
87.600 87.600 87.600
SM3 Framework (M): 5 Sheep
chromosome 5
98.500 98.500 98.500
SM4 Best Positions (A): 5 Sheep
chromosome 5
90.300 90.300 90.300
SM4 Framework (A): 5 Sheep
chromosome 5
92.800 92.800 92.800
SM4 Framework (F): 5 Sheep
chromosome 5
87.800 87.800 87.800
SM4 Framework (M): 5 Sheep
chromosome 5
98.500 98.500 98.500
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
94.300 94.300 94.300
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
80.400 80.400 80.400
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
107.400 107.400 107.400
SM4.2 Framework (A): 5 Sheep
chromosome 5
97.200 97.200 97.200
SM4.2 Framework (F): 5 Sheep
chromosome 5
86.600 86.600 86.600
SM4.2 Framework (M): 5 Sheep
chromosome 5
108.600 108.600 108.600


© The Roslin Institute 2007-2012, all rights reserved