This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011111


Marker Name:  CSRD2134 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TGAGCAGCACACAACCCAAATATT
Primer: TCTTCTTTACATAAATGCGTGCGC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 Best Positions (A): 5 Sheep
chromosome 5
134.200 134.200 134.200
SM3 Best Positions (F): 5 Sheep
chromosome 5
136.200 136.200 136.200
SM3 Best Positions (M): 5 Sheep
chromosome 5
133.200 133.200 133.200
SM4 Best Positions (A): 5 Sheep
chromosome 5
141.400 141.400 141.400
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
140.700 140.700 140.700
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
140.200 140.200 140.200
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
142.700 142.700 142.700


© The Roslin Institute 2007-2012, all rights reserved