This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010995


Marker Name:  CAST 
Species:  Sheep
Marker Type:  SSCP
Publication ID: 11435411

PCR Primers

Primer: TCTTCTTTTCTCTTTGGGTGGA
Primer: CTTGTCATCCGACTTCACCT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF016006

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 5 Sheep
chromosome 5
132.400 132.400 132.400
SM3 Best Positions (A): 5 Sheep
chromosome 5
130.400 130.400 130.400
SM3 Best Positions (F): 5 Sheep
chromosome 5
134.100 134.100 134.100
SM3 Best Positions (M): 5 Sheep
chromosome 5
127.900 127.900 127.900
SM3 Framework (F): 5 Sheep
chromosome 5
139.700 139.700 139.700
SM3 Framework (M): 5 Sheep
chromosome 5
126.900 126.900 126.900
SM4 Best Positions (A): 5 Sheep
chromosome 5
137.600 137.600 137.600
SM4 Framework (A): 5 Sheep
chromosome 5
133.300 133.300 133.300
SM4 Framework (F): 5 Sheep
chromosome 5
142.600 142.600 142.600
SM4 Framework (M): 5 Sheep
chromosome 5
125.100 125.100 125.100
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
136.900 136.900 136.900
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
138.100 138.100 138.100
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
137.400 137.400 137.400
SM4.2 Framework (A): 5 Sheep
chromosome 5
140.700 140.700 140.700
SM4.2 Framework (F): 5 Sheep
chromosome 5
145.900 145.900 145.900
SM4.2 Framework (M): 5 Sheep
chromosome 5
138.500 138.500 138.500
SM4.6 Best Positions (A): 5 Sheep
chromosome 5
138.900 138.900 138.900
SM4.6 Best Positions (F): 5 Sheep
chromosome 5
143.000 143.000 143.000
SM4.6 Best Positions (M): 5 Sheep
chromosome 5
137.900 137.900 137.900
SM4.7 Best Positions (A): 5 Sheep
chromosome 5
138.900 138.900 138.900


© The Roslin Institute 2007-2012, all rights reserved