This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010916


Marker Name:  BMS2258 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: CCAGCAGAAGAGAAAGATACTGA
Primer: AGTGGTAGAACTTCCATCTCACA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18961

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Beraldi, Dario et al 2006 (A): 5 Sheep
chromosome 5
71.600 71.600 71.600
SM2 (A): 5 Sheep
chromosome 5
81.600 81.600 81.600
SM3 (A): 5 Sheep
chromosome 5
88.000 88.000 88.000
SM3 Best Positions (A): 5 Sheep
chromosome 5
86.100 86.100 86.100
SM3 Best Positions (F): 5 Sheep
chromosome 5
80.800 80.800 80.800
SM3 Best Positions (M): 5 Sheep
chromosome 5
91.100 91.100 91.100
SM3 Framework (F): 5 Sheep
chromosome 5
85.300 85.300 85.300
SM3 Framework (M): 5 Sheep
chromosome 5
91.900 91.900 91.900
SM4 Best Positions (A): 5 Sheep
chromosome 5
85.600 85.600 85.600
SM4 Framework (A): 5 Sheep
chromosome 5
88.000 88.000 88.000
SM4 Framework (F): 5 Sheep
chromosome 5
85.300 85.300 85.300
SM4 Framework (M): 5 Sheep
chromosome 5
91.900 91.900 91.900
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
89.600 89.600 89.600
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
77.900 77.900 77.900
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
100.800 100.800 100.800
SM4.2 Framework (A): 5 Sheep
chromosome 5
92.400 92.400 92.400
SM4.2 Framework (F): 5 Sheep
chromosome 5
84.200 84.200 84.200
SM4.2 Framework (M): 5 Sheep
chromosome 5
102.100 102.100 102.100
SM4.6 Best Positions (A): 5 Sheep
chromosome 5
87.300 87.300 87.300
SM4.6 Best Positions (F): 5 Sheep
chromosome 5
73.200 73.200 73.200
SM4.6 Best Positions (M): 5 Sheep
chromosome 5
101.200 101.200 101.200
SM4.7 Best Positions (A): 5 Sheep
chromosome 5
87.300 87.300 87.300
SMC (A): 5 Sheep
chromosome 5
81.600 81.600 81.600


© The Roslin Institute 2007-2012, all rights reserved