This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010788


Marker Name:  BMS0792 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: AGCATGTATCCAATCTACCCTG
Primer: GCAAGCCCTAGGCTGAAA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18879

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 5 Sheep
chromosome 5
84.200 84.200 84.200
SM3 (A): 5 Sheep
chromosome 5
91.100 91.100 91.100
SM3 Best Positions (A): 5 Sheep
chromosome 5
89.200 89.200 89.200
SM3 Best Positions (F): 5 Sheep
chromosome 5
82.000 82.000 82.000
SM3 Best Positions (M): 5 Sheep
chromosome 5
95.800 95.800 95.800
SM3 Framework (F): 5 Sheep
chromosome 5
86.500 86.500 86.500
SM3 Framework (M): 5 Sheep
chromosome 5
96.700 96.700 96.700
SM4 Best Positions (A): 5 Sheep
chromosome 5
88.700 88.700 88.700
SM4 Framework (A): 5 Sheep
chromosome 5
91.100 91.100 91.100
SM4 Framework (F): 5 Sheep
chromosome 5
86.500 86.500 86.500
SM4 Framework (M): 5 Sheep
chromosome 5
96.700 96.700 96.700
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
92.700 92.700 92.700
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
79.000 79.000 79.000
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
105.600 105.600 105.600
SM4.2 Framework (A): 5 Sheep
chromosome 5
95.500 95.500 95.500
SM4.2 Framework (F): 5 Sheep
chromosome 5
85.300 85.300 85.300
SM4.2 Framework (M): 5 Sheep
chromosome 5
106.800 106.800 106.800
SMC (A): 5 Sheep
chromosome 5
84.200 84.200 84.200


© The Roslin Institute 2007-2012, all rights reserved