This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010751


Marker Name:  BMS0522 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: CTTGCTTACTGCTTGCTATGAA
Primer: CCCAACAAAATTTCTGATTCTC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 5 Sheep
chromosome 5
131.400 131.400 131.400
SM3 (A): 5 Sheep
chromosome 5
136.900 136.900 136.900
SM3 Best Positions (A): 5 Sheep
chromosome 5
135.500 135.500 135.500
SM3 Best Positions (F): 5 Sheep
chromosome 5
136.200 136.200 136.200
SM3 Best Positions (M): 5 Sheep
chromosome 5
135.100 135.100 135.100
SM3 Framework (F): 5 Sheep
chromosome 5
139.700 139.700 139.700
SM3 Framework (M): 5 Sheep
chromosome 5
134.200 134.200 134.200
SM4 Best Positions (A): 5 Sheep
chromosome 5
142.600 142.600 142.600
SM4 Framework (A): 5 Sheep
chromosome 5
137.800 137.800 137.800
SM4 Framework (F): 5 Sheep
chromosome 5
142.600 142.600 142.600
SM4 Framework (M): 5 Sheep
chromosome 5
132.400 132.400 132.400
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
142.000 142.000 142.000
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
140.200 140.200 140.200
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
144.600 144.600 144.600
SM4.2 Framework (A): 5 Sheep
chromosome 5
145.200 145.200 145.200
SM4.2 Framework (F): 5 Sheep
chromosome 5
145.900 145.900 145.900
SM4.2 Framework (M): 5 Sheep
chromosome 5
145.700 145.700 145.700
SMC (A): 5 Sheep
chromosome 5
131.400 131.400 131.400


© The Roslin Institute 2007-2012, all rights reserved