This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010688


Marker Name:  BM9289 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: TTGACCAAAGTCAAGAATAGTTTG
Primer: GTTTAAAAGTCCCAATCCCAA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18816

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 5 Sheep
chromosome 5
1.900 1.900 1.900
SM3 Best Positions (A): 5 Sheep
chromosome 5
15.300 15.300 15.300
SM3 Best Positions (F): 5 Sheep
chromosome 5
16.000 16.000 16.000
SM3 Best Positions (M): 5 Sheep
chromosome 5
13.400 13.400 13.400
SM4 Best Positions (A): 5 Sheep
chromosome 5
15.300 15.300 15.300
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
19.300 19.300 19.300
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
14.700 14.700 14.700
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
23.500 23.500 23.500
SM4.6 Best Positions (A): 5 Sheep
chromosome 5
16.500 16.500 16.500
SM4.6 Best Positions (F): 5 Sheep
chromosome 5
10.000 10.000 10.000
SM4.6 Best Positions (M): 5 Sheep
chromosome 5
23.500 23.500 23.500
SM4.7 Best Positions (A): 5 Sheep
chromosome 5
16.500 16.500 16.500
SMC (A): 5 Sheep
chromosome 5
1.900 1.900 1.900


© The Roslin Institute 2007-2012, all rights reserved