This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010569


Marker Name:  BM1853 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: AGCCTTTTGTAGGTGTTCATTG
Primer: ATGGGGTTGCAAAGAGTCAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18401

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 5 Sheep
chromosome 5
16.300 16.300 16.300
SM2 (A): 5 Sheep
chromosome 5
95.700 95.700 95.700
SM3 (A): 5 Sheep
chromosome 5
102.900 102.900 102.900
SM3 Best Positions (A): 5 Sheep
chromosome 5
100.900 100.900 100.900
SM3 Best Positions (F): 5 Sheep
chromosome 5
92.900 92.900 92.900
SM3 Best Positions (M): 5 Sheep
chromosome 5
106.900 106.900 106.900
SM3 Framework (F): 5 Sheep
chromosome 5
97.500 97.500 97.500
SM3 Framework (M): 5 Sheep
chromosome 5
107.800 107.800 107.800
SM4 Best Positions (A): 5 Sheep
chromosome 5
99.000 99.000 99.000
SM4.2 Best Positions (A): 5 Sheep
chromosome 5
102.900 102.900 102.900
SM4.2 Best Positions (F): 5 Sheep
chromosome 5
91.900 91.900 91.900
SM4.2 Best Positions (M): 5 Sheep
chromosome 5
112.800 112.800 112.800
SM4.6 Best Positions (A): 5 Sheep
chromosome 5
103.200 103.200 103.200
SM4.6 Best Positions (F): 5 Sheep
chromosome 5
91.000 91.000 91.000
SM4.6 Best Positions (M): 5 Sheep
chromosome 5
115.100 115.100 115.100
SM4.7 Best Positions (A): 5 Sheep
chromosome 5
103.200 103.200 103.200
SMC (A): 5 Sheep
chromosome 5
95.700 95.700 95.700


© The Roslin Institute 2007-2012, all rights reserved