This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003982


Marker Name:  SWR2480 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TTGAGGAACTGCCCTACTGG
Primer: ACTGGTTATGGAGCATGATGG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009081

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 16 Pig
chromosome 16
52232520.000 52232632.500 52232745.000
ENSEMBL56 Sscrofa9 Pig Assembly: 16 Pig
chromosome 16
63625556.000 63625668.500 63625781.000
ENSEMBL67 Ssc10.2 Pig Assembly: 16 Pig
chromosome 16
71797057.000 71797169.500 71797282.000
NIAI-Japan QTL v2 (A): 16 Pig
chromosome 16
71.300 71.300 71.300
NIAI-Japan v1 (A): 16 Pig
chromosome 16
56.400 56.400 56.400
NIAI-Japan v1 (F): 16 Pig
chromosome 16
75.100 75.100 75.100
NIAI-Japan v1 (M): 16 Pig
chromosome 16
39.500 39.500 39.500
USDA-MARC current (A): 16 Pig
chromosome 16
55.700 55.700 55.700
USDA-MARC v2 (A): 16 Pig
chromosome 16
55.700 55.700 55.700


© The Roslin Institute 2007-2012, all rights reserved