This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003875


Marker Name:  SW977 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: GATCAAGGTGAGTCTGACATTAA
Primer: CGTCACAAGTGCAGCCTTTA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL67 Ssc10.2 Pig Assembly: 16 Pig
chromosome 16
58970415.000 58970463.500 58970512.000
NIAI-Japan QTL v2 (A): 16 Pig
chromosome 16
55.800 55.800 55.800
NIAI-Japan v1 (A): 16 Pig
chromosome 16
41.700 41.700 41.700
NIAI-Japan v1 (F): 16 Pig
chromosome 16
58.300 58.300 58.300
NIAI-Japan v1 (M): 16 Pig
chromosome 16
26.700 26.700 26.700
USDA-MARC current (A): 16 Pig
chromosome 16
44.200 44.200 44.200
USDA-MARC v1 (A): 16 Pig
chromosome 16
42.600 42.600 42.600
USDA-MARC v2 (A): 16 Pig
chromosome 16
44.200 44.200 44.200


© The Roslin Institute 2007-2012, all rights reserved