This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003800


Marker Name:  SW813 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: AGTTGATTTAAAATGTTGTGCCA
Primer: AATATTTCAAAAAAAGGAATGCG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008954

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 16 Pig
chromosome 16
4145999.000 4146050.000 4146101.000
ENSEMBL56 Sscrofa9 Pig Assembly: 16 Pig
chromosome 16
5716039.000 5716090.000 5716141.000
NIAI-Japan QTL v2 (A): 16 Pig
chromosome 16
0.000 0.000 0.000
NIAI-Japan v1 (A): 16 Pig
chromosome 16
0.000 0.000 0.000
NIAI-Japan v1 (F): 16 Pig
chromosome 16
0.000 0.000 0.000
NIAI-Japan v1 (M): 15 Pig
chromosome 15
0.000 0.000 0.000
USDA-MARC current (A): 16 Pig
chromosome 16
6.000 6.000 6.000
USDA-MARC v1 (A): 16 Pig
chromosome 16
0.000 0.000 0.000
USDA-MARC v2 (A): 16 Pig
chromosome 16
6.000 6.000 6.000


© The Roslin Institute 2007-2012, all rights reserved