This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003683


Marker Name:  SW403 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: GTGTATGTTCATGCATGGGTG
Primer: GTCTCTGCTTTGCTTGCATG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008866

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 16 Pig
chromosome 16
15634014.000 15634064.500 15634115.000
ENSEMBL56 Sscrofa9 Pig Assembly: 16 Pig
chromosome 16
20813420.000 20813470.500 20813521.000
ENSEMBL67 Ssc10.2 Pig Assembly: 16 Pig
chromosome 16
24587162.000 24587212.500 24587263.000
NIAI-Japan QTL v2 (A): 16 Pig
chromosome 16
28.200 28.200 28.200
NIAI-Japan v1 (A): 16 Pig
chromosome 16
21.000 21.000 21.000
NIAI-Japan v1 (F): 16 Pig
chromosome 16
30.500 30.500 30.500
NIAI-Japan v1 (M): 16 Pig
chromosome 16
13.200 13.200 13.200
USDA-MARC current (A): 16 Pig
chromosome 16
27.600 27.600 27.600
USDA-MARC v1 (A): 16 Pig
chromosome 16
27.000 27.000 27.000
USDA-MARC v2 (A): 16 Pig
chromosome 16
27.600 27.600 27.600


© The Roslin Institute 2007-2012, all rights reserved