This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003625


Marker Name:  SW262 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: TACTTGGCTTTTTGTGACCAG
Primer: TCAGCCAAAGGGCTCTTG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008823

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 16 Pig
chromosome 16
49277331.000 49277431.500 49277532.000
ENSEMBL56 Sscrofa9 Pig Assembly: 16 Pig
chromosome 16
59954262.000 59954362.500 59954463.000
ENSEMBL67 Ssc10.2 Pig Assembly: 16 Pig
chromosome 16
67649164.000 67649264.500 67649365.000
NIAI-Japan QTL v2 (A): 16 Pig
chromosome 16
63.100 63.100 63.100
NIAI-Japan v1 (A): 16 Pig
chromosome 16
49.800 49.800 49.800
NIAI-Japan v1 (F): 16 Pig
chromosome 16
70.100 70.100 70.100
NIAI-Japan v1 (M): 16 Pig
chromosome 16
31.400 31.400 31.400
USDA-MARC current (A): 16 Pig
chromosome 16
46.900 46.900 46.900
USDA-MARC v1 (A): 16 Pig
chromosome 16
65.800 65.800 65.800
USDA-MARC v2 (A): 16 Pig
chromosome 16
46.900 46.900 46.900


© The Roslin Institute 2007-2012, all rights reserved